Перезагрузить Линукс из памяти

Похоже, что Apple не перенесет "запустить скрипт" функциональность из iCal в календарь в Mac ОС X 10.8, он же горный лев.

Вы можете назначить запуск приложений на Mac ОС X в ряд способов.

Встроенные Средства Планирования

Выбранный встроенный планирование способ-использовать файл launchd (запуск демона). Чтобы использовать файл launchd вы создаете файл launchd работу авиабилетов и поместить их в свой ~/библиотеки/LaunchAgents/ папку.

хрон доступна на Mac с OS X, но не рекомендуется. Однако, есть много графиков, чем можно представить хрон , а не файл launchd.

Яблочный файл launchd документация является хорошим местом для начала.

Третий Инструмент Планирования Партии

Если вы хотите графический интерфейс и большую функциональность, есть сторонние приложения, доступные. Моя компания развивает мощность управляющего; другие решения тоже существуют.

+226
Sez 13 мар. 2016 г., 20:43:44
20 ответов

Кто-нибудь знает как подать заявку на американскую транзитную визу для путешествия через Америку, но не остался? Я не могу найти ничего в интернете.

+961
Erwin Jumadiao 03 февр. '09 в 4:24

Какие флаги можно использовать с Пакман -Ы показать только те пакеты, которые еще не установили?

Приму скрипт, если это не может быть сделано. Спасибо.

+922
Rize Tours 24 дек. 2013 г., 18:59:21

Я пишу специальной команды awk в Cygwin к процессу табуляцией файлы. Практически каждая команда начинается с:

Начать {ДФ="\т";компания OFS="\T", в ОРС="\г\п";} 

Как я могу сделать эти разделители по умолчанию, чтобы не вводить их каждый раз?

+820
NmGodzz 16 нояб. 2018 г., 08:25:24

Распространенным способом обработки заявок на гранты, кажется, в комментарии, на который заявитель может отвечать. Отзывы и ответ вместе обсуждаются на панель, где предложения выстроены в ряд, а сверху х%, то финансируются.

Я оказался в красивой, но запутанной ситуации: я получил назад комментарии к мой первый грант, и все эксперты дали высшие оценки (и очень положительные отзывы). Теперь я задаюсь вопросом, является ли или не использовать право на ответ, все данные которые я смог найти ответы сводятся к решению критики, но что делать, если нет критики?

Редактировать: агентство гранта явно не рекомендует использовать ответ, чтобы поблагодарить рецензентов. Альтернативный вариант к тому же не отвечая на все можно попытаться выборочно соглашаетесь с наиболее восхваляющие комментарии или что-то подобное, но я не уверен, что это хорошая идея.

+771
Davidson Peter 14 авг. 2010 г., 00:37:11

Вы использовать Yum для удаления его?

Я хотел бы проверить для любого стартапа/выскочка/инит.D скрипты, которые могут быть сохраняющиеся вокруг.

В крайнем случае, если нет никаких скриптов автозагрузки, вы можете попробовать перенести его в каталог /tmp/:

судо МВ, по которым команда sosreport` /tmp/и
+698
Kumar Manglam 29 апр. 2022 г., 17:53:11

Если я хочу начать установленной системе обслуживания, я могу сделать:

# в /etc/инит.д/некоторые-ВПВ начать
# initctl Start некоторые-ВПВ
# услуги какой-ВПВ начать
# начать-ВПВ

Если я хочу, чтобы отключить услугу от запуска при загрузке, я могу сделать:

# РМ в /etc/RC2 уже.д/S99some-ВПВ
обновление-РЦ#.D некоторые-ВПВ отключить
# МВ /етц/инит/какой-ВПВ.конф в /etc/инит/какой-ВПВ.конф.отключен

То есть точно так же разные вещи я могу сделать, чтобы дать сервисы для запуска при загрузке, и так далее.

Я в курсе того, что выскочка-это (относительно) новая вещь, и я знаю о том, как с SysV инициализации используется для работы, и я смутно слышала кучу Д-автобус бред, но то, что я не знаю, как это на самом деле предназначены для взаимодействия с этим материалом. Например, я не знаю, как легко определить, является ли услуга выскочка работу или в наследство с SysV вещь, без прочтения обширно источником его скриптов.

Так вот: если я хочу, чтобы запустить или остановить службу, либо в данный момент или постоянно, какой из этих инструментов должен использовать, и почему? Если ответ зависит от некоторых атрибутов (например, "эта служба поддерживает выскочка"), то как я могу быстро и легко узнать о том, что атрибут установленного пакета?

В связи с вышесказанным, есть ли инструменты, пользовательский интерфейс, который может безопасно и правильно взаимодействовать с современной инфраструктурой обслуживания (выскочка, и/или независимо от его совместимости с SysV есть)? Например, я мог надежно использовать с SysV-RC автомобилей-конф , чтобы определить, какие услуги должен начать?

+674
Perry E Jones 24 мая 2022 г., 13:21:29

Я делюсь экраном с 10.6.8 имак, глядя на МасВоок Pro 10.8. Довольно часто, но не всегда, общий экран выглядит вот так на мой компьютер.

enter image description here

(Это изображение является анонимной.) Так что есть реальная общим экраном вниз, и перевернутый кусок сверху. Ни одна часть является активной, в том, что я ничего не могу сделать на них удаленно. Что происходит? Установка дисплея облажался на одной машине? Помогите! Это действительно раздражает. Я могу легко сделать экран обмена на другие машины.

+645
Superion 17 сент. 2015 г., 04:25:09

Я должен выехать в Гватемалу для делового визита. Я подала документы на бизнес-визу Гватемалы. Может некоторые информированные консультанта или опытного человека, руководство мне с правильными требованиями?

Из информации я собрал, мне требуется следующее:

1) сопроводительное письмо от индийской компании
2) Оригинальный жесткий копию деловое письмо приглашение из Гватемалы в испанском языке
3) правильные действия паспорта
4) выписка из банка заявителя за последние 6 месяцев оригинал с печатью банка и подписью уполномоченного лица банка или международной кредитной карточки-копия, или дорожные чеки на имя заявителя, сумма должна быть эквивалентной 5000 долларов США
5) авиабилеты (к-от)
6) подтверждение адреса, фото, копия паспорта и прочие документы
7) сертификат коммерческой регистрации приглашения Гватемалы компании





Может любой опытный человек, руководство мне, если все выше документов будет достаточно или какие-либо другие дополнительные требования должны быть выполнены?

Также может кто-нибудь объяснит мне про пункт 7 ? А что такое дорожный чек?

+619
jmoukel 2 июн. 2022 г., 03:44:58

Я не вижу смысла в использовании только грэп(ы), если это не строгое ограничение. Это нельзя сделать одним звонком в грэп.

грэп -2 в "почтовой системы" mbox_file | хвоста -н +3
  • грэп: найти строку и вывести 2 строки после,
  • хвост: вырезать первые 2 линии (т. е. начать с третьей линии).
+612
qwerqwerqwersdf adzxvzxcvzxcv 8 янв. 2011 г., 08:35:49

Возможные Дубликаты:
Иногда обновление рынка застрять загрузки, как я могу отменить?

У меня есть Android 1.6 в оригинальной Г1. Я попытался установить последний.Приложений FM и это не удалось. С тех пор я всегда видел в прошлом.ФМ там в процессе установки и не могут быть отменены или удалены или ничего.

И что еще хуже: после установки нового приложения перестали работать вообще. Возвращались всегда через некоторое время с "[Приложение] не удалось скачать. Повторите попытку позже".

Любая идея, как "разблокировать" снова на рынке?

+563
user687405 5 февр. 2015 г., 13:25:24

Существует много формул для расчета необходимых калорий. Некоторые из них даже основаны на науке. Однако, поскольку каждый человек имеет различные требования, основанные на образе жизни и т. д. Я считаю, что лучший способ контролировать и отслеживать калорий, чтобы стать осведомленным на размеры порций и содержания пищи. Поэтому, отвечая на ваш первый вопрос, я бы не использовать конкретные формулы. Скорее всего, я буду держать журнал пищи, что отследить количество калорий и питательных веществ, потребляемых за базовый период времени (скажем, две недели например). При всех равных условиях, если вы сможете поддерживать свой текущий вес за это время, что должно обеспечить содержание калорий и питательных веществ составляет. Теперь, второй вопрос. Имея свободно рассчитанное количество калорий обслуживания, легко сделать небольшой (например. 250 до 500 калорий) корректировки, чтобы поднять/снизить потребление калорий на основе ваших целей. Я бы повторить этот процесс на регулярной (6 месяцев?) основе, опять же, исходя из ваших конкретных целей.

Наиболее важная концепция, чтобы понять, не догадаться, на что вы потребляете питательных веществ. Большинство людей думаю, на низкой стороне и занижают потребление калорий.

+550
Mastemah 27 сент. 2014 г., 02:22:50

Мы действительно не можем ответить, будет ли школу вы послали специально учитывая, что вы, но есть три основные причины, которые могут вызвать у них спросить за результат (независимо от того, как/почему они сказали, что у них его нет). Главное понять, что поступление в магистратуру (по крайней мере в США) является составной процесс с участием кафедры и аспирантуры.

В порядке наименее обнадеживающим самое обнадеживающее (для перспективы):

  1. Выпускник школы может иметь либо политики, они лишь переходят на полную записей и просмотренных вами как неполные или выпускник школы хочет полные записи для всех претендентов на ведение бухгалтерского учета.
  2. Департамент не располагает данными и хочет перед началом оценки заявок на всех. С хорошей стороны = это будет означать отдела смотрит на него. Плохая сторона = некоторые отделы в некоторых областях использовать отсечения на основе документа GRE баллы, чтобы отрубить самых неожиданных кандидатов (естественно с исключениями по аналогии)
  3. Отдела и/или выпускник школы делает выбор и должен завершить файлы перед отправкой предложения. Чуть менее позитивно, возможно, они нуждаются в этом тай-брейке, чтобы выяснить последний кандидат.

Очевидно, что три было бы здорово, но часто причины эти запросы гораздо более приземленные.

+496
jofl 13 окт. 2019 г., 04:30:18

В Ubuntu GNOME, но вы можете отключить запрос пароля на Настройки/яркость, убрав флаг из "замка" и/или "заблокировать экран после выхода из ждущего"...попробовать и проверить, если есть что-то похожее на единство!

+402
zeevb 14 апр. 2023 г., 07:15:52

Я скачал и установил его (благодаря, в основном, для этих парней в разделе: Как я могу установить Python 3.3?) и гид, узнав, что я использую объясняет, что размещение установки в папке Downloads не может быть лучшей идеей для пользователей Windows. Это дело для меня используете Ubuntu? Если так, я могу просто скопировать и вставить его в другом месте? Где может быть хорошее место? Спасибо!

+362
Hossam Hamdy 23 сент. 2021 г., 19:11:50

На мой вопрос следует, что один: файл(1) и магия(5) : описываю другие форматы .

Я хочу описать последовательность в формате fasta ( http://en.wikipedia.org/wiki/FASTA_format)

Это может быть последовательность ДНК (только ATGC)

>заголовок
ATGCTAGCATAGCATCGATGCTGTAGCTACGTAGCTACGTCTACG

'Волшебной' узор будет

>.*\Н[ATGC]*

или белка последовательности ( ACDEFGHIKLMNPQRSTVWYBZX содержащих ATGC тоже)

>заголовок
AHITKLMNPQRGHIKLMNPQRC

'Волшебной' узор будет

>.*\Н[ACDEFGHIKLMNPQRSTVWYBZX]*

Но всякий раз, когда я использовать регулярные выражения, файл мне подсказывает, что это белка, потому что это соответствует 2-й регулярному выражению. Есть ли способ, чтобы определить приоритеты в результате ? Есть ли способ, чтобы proritize , что-то вроде "не пытайтесь любой другой рисунок, если это соответствует ? ".

+342
Josh Vickery 8 янв. 2018 г., 10:13:44

http://en.gentoo-wiki.com/wiki/CUPS

Если вы используете USB->параллельный адаптер, вам нужно выполнить следующие действия:

Добавьте свой принтер, выбрав другой тип соединения (с USB и параллельный не будет в списке)
Отредактируйте файл /etc/чашки/принтеры.конф
Измените строку идентификатора устройства для чтения: свойство DeviceID = параллельная: на/dev/интерфейс USB/lp0
...на самом деле, это похоже на правильную линию сейчас: DeviceURI параллель: как/dev/от USB/lp0 

Примечание: что это "параллельные" не "USB-подключение" - USB-часть обрабатывается драйверы USB. В чашки она должна отображаться как параллельный порт. Чашки не знаешь для USB->параллельные адаптеры, но если вы вручную его настроить, он будет работать

+337
Aydin Gerek 5 февр. 2017 г., 23:53:06

Антипригарный спрей просто масла добавить эмульгаторы, чтобы сделать его non-липкий. Это не более опасно, чем при сгорании масла, которые вы применяете к вашим мясом.

Распылять масло на колосниковой решетке также поможет сезон и сохранить его от коррозии.

Самая главная причина не делать этого, когда решетка горячая заключается в том, что распыляется масло весьма огнеопасными. Что сказал, я спрей антипригарный спрей на гриле и наслаждаться пиротехника.

+334
Dhinesh Rozario 10 авг. 2011 г., 11:16:35

Я пытаюсь использовать Ubuntu 12.04. от USB с 4 ГБ peristent часть. Сначала я изменил некоторые параметры монитора (два). После перезагрузки я получил сообщение об ошибке:

Не удалось применить сохраненную конфигурацию мониторов. Не удалось открыть файл 
 '/home/ubuntu/.config/monitors.xml.xml': ошибка ввода/вывода 

После этого я снова изменил настройки. После нажатия на кнопку Сохранить, я получил следующее сообщение об ошибке.

Не могу сохранить настройки монитора. Не удалось создать файл 
 '/дома/Убунту/.конфигурации/мониторы.в формате XML.EO8ASW': недопустимый аргумент

Я нашел несколько вопросов с такой же проблемой. Ответ удалить monitors.xml файл. Но я не могу найти .конфиг папку в Ubuntu папку.

Как я могу изменить/удалить файл monitors.xml или как я могу создать новый?

+295
Steve Hernandez 14 июл. 2018 г., 22:07:35

Я в настоящее время серьезно рассматривает возможность потратить пару месяцев жизни в городе Лилль на севере Франции, в основном, чтобы попытаться улучшить мой французский. Я планирую быть там слишком долго для общежития или гостиницы, так что я после чего-то более постоянного. Квартиры/доли дома возможно, но учитывая количество друзей и семьи, которые решили, что хочу приехать, я бы лучше делал короткие пусть на плоскую.

Я посмотрел на кухне, и есть некоторые подходящие ухаживающие свойства в продаже есть, так что это один вариант. Однако, я не могу помочь, но думаю, что будет больше в другом месте, особенно на французских сайтах, если бы я только знал, где искать! Я может быть не так, как я не знаю много о французской правил аренды...

За кухне, где я должна была искать короткий (несколько месяцев) квартира в аренду в Лилль? Любой крупный веб-сайты, чтобы проверить? Каких-либо ключевых фраз в Google для? Любой вид специального проката, я должен пытаться найти + говорить?

(Обратите внимание, что я не После "мой друг Джим квартиру, поговорить с ним", больше похоже на "почти все нравится, что во Франции заканчивается на сайт X" или "вам нужно найти агентства, которые говорит, что они специализируются на Y и работа с ними")

+291
Guilherme Henrique Luchesi 6 мая 2015 г., 09:10:02

Я закончил составление моно с нуля, вместо этого, используя tar-файлов с сервера загрузка, и она работала. Как ни странно, это неловко, но я отвечал на подобный вопрос 3 года назад. Я попробовал Google поиск, и наткнулся на мой собственный вопрос (что ответили) 3 года назад на обмен стека. Для тех, кто ищет, как просто скомпилировать его с нуля, вместо того, чтобы 4.6.0 читайте здесь мои старые нити.

Предыдущий Поток Обмена Стека С Ответом

Единственное, что вам нужно сделать, это разных обновление с wget связи с последними пакетами из моноса файлового сервера. Все остальное работает так же!

+260
A Gardener 5 нояб. 2015 г., 04:16:34

Показать вопросы с тегом